Creation by Adam Rutherford

£10.99
Available
Product Ref. (e.g. ISBN, SKU)
9780241954690
Published:
06 Feb 2014
Format:
Paperback
Number of pages:
272 pages
Dimensions:
198x129x17mm
Weight:
0.191kgs
Author:
Recent breakthroughs in the science of life are solving the great mystery of its origin while giving us the power to design its future. Presented here back-to-back, these two gripping narratives reveal the full story of creation.

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

About the Author: Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

More Information
Number of pages 272

We will despatch your order as quickly as we can. If, for whatever reason, a product is out of stock we will contact you to discuss the likely delivery time or an alternative product.

  First Item 2 Items & Over
UK £3.75 £5.00
EU £15.00 £30.00
USA & Canada £30.00 £50.00
Rest of the World £45.00 £60.00
Collect in Store free free

Additional Delivery Information (and some really important bits):

UK Delivery

Orders for delivery in the UK are despatched by Courier and Signed For delivery services and will normally be delivered to you within a few days of placing your order. Signed Books are shipped in our specially made book mailing cartons, with the books themselves wrapped in paper to protect them. Sometimes we may ship your order in several parts, particularly if you have 'Pre-Order' titles in your order or titles which are held in stock with our publishing partners.

The Really Important Bit: Because we use courier and signed for delivery services, please use an address at which your parcel can be signed for during the normal working day, for example, you may want to have your order delivered to your work address if you're not at home during the day.

First Item @ £3.75 (sometimes a shipping supplement may be added for particularly heavy books or specific postcodes*)
2 Items & over @ £5.00 in total

Another Really Important Bit: There are a number of Postcodes in the UK for which we will need to charge a shipping supplement, this will be calculated once we know the size and weight of the shipment. For these orders we will contact customers to agree a suitable and economic method of shipping. There may also be additional time required for delivery to some areas of the United Kingdom. Where possible, we will ship single book orders (under 2kg) by Royal Mail to all UK postcodes. Multiple book orders and books over 2kg are shipped via APC Overnight, regardless of Postcode.

Overseas Delivery

Shipments to EU countries:

First Item @ £15.00 (sometimes a shipping supplement will be added for particularly heavy books)
2 Items & over @ £30.00 in total

A really, really important Brexit bit: From 1st January 2021 shipments to EU addresses may incur additional costs which could be requested by Fed Ex at the time of delivery. These costs may vary from country to country and are not within our control and will be in addition to the costs paid to us for your delivery. If in any doubt, please check with your local Fed Ex office what, if any, additional costs will be applicable to your order - https://www.fedex.com
From 1st July 2021, VAT will be applicable to those EU countries where VAT is applied to books - this additional charge will be collected by Fed Ex (or the Royal Mail) at the time of delivery.

Shipments to the USA & Canada:

First Item @ £30.00
2 Items & over @ £50.00 in total

Shipments to the Rest of the World:

First Item @ £45.00
2 Items & over @ £60.00 in total

All overseas orders are shipped using a 'signed for' courier service - please provide an address at which your parcel can be signed for on receipt. We use the same packaging materials for our overseas deliveries as we do those in the UK. In some cases, particularly large and heavy books, or books being shipped to remote areas, may incur an additional shipping charge - if this is the case with your order, we'll notify you as quickly as possible of these charges and to arrange the additional payment. You can of course cancel your order with an immediate refund should you not wish to accept these additional costs. Shipments to overseas territories may incur additional Duty & Tax costs which could be requested by Fed Ex at the time of delivery. These costs may vary from country to country and are not within our control and will be in addition to the costs paid to us for your delivery. If in any doubt, please check with your local Fed Ex office what, if any, additional Tax & Duty costs will be applicable to your order - https://www.fedex.com

Collect in Person at Coles Books

We're open Monday - Saturday, 9:00am - 5:30pm. If you're collecting your order, please wait until you get the text, phone call or email from us, just to be on the safe side and to ensure we have your order ready for you on arrival (we'll use the contact information provided during checkout). Not everything on our website is available for immediate collection, please do wait for the text, call or email - if time is of the essence, we'd suggest you call us on 01869 320779 and check availability prior to placing your order. You can pick up your order from the till, please bring a copy of your email receipt (electronic or printed is fine).

Coming by Car

If you're coming to Coles by car, why not take advantage of the 2 hours free parking at Sainsbury's Pioneer Square - just follow the signs for Pioneer Square as you drive into Bicester and park in the multi-storey car park above the supermarket. Come down the travelators, exit Sainsbury's, turn right and follow the pedestrianised walkway to Crown Walk and turn right - and Coles will be right in front of you. You don't need to shop in Sainsbury's to get the free parking!

Where to Find Us

Coles Books
22 Crown Walk
Pioneer Square
Bicester, Oxfordshire
OX26 6HY, United Kingdom

It was the most impressive packaging that I have EVER SEEN!!! The books were in perfect condition!!!!!

Super fast delivery and well packaged. Quality item and service!

Copyright © Coles Books - a Danny Boy Trading Company. All rights reserved.